Internal Ribosome Entry Sites (IRES)

IRES sequences are used to express two proteins from a single promoter in an expression construct or a transgenic construct. A single RNA is produced but due to the presence of the IRES, a second translational start is possible on the same RNA. These sequences where identified in viral genomes where efficient use of limited nucleotide length is valuable. IRES sequences where quickly adopted for use in expression vectors, often to express a protein under study along with a reporter (e.g. luciferase) to quantitate expression levels in transfected cell lines. Labs and companies made subtle changes to tweak the system to adapt the function to different uses. For example, an attenuated version was produce so that the second protein, the reporter luciferase or GFP, was expressed at a lower level. The rationale for this was that if there was any detectable reporter, then the protein if interest should be present and at higher levels. A problem that I’ve seen come up is that labs inadvertently incorporated such attenuated versions, expecting equal expression levels of the two proteins and subsequently became frustrated at the results. This confusion led to anecdotes of IRES failures and a reluctance to use this strategy. It also led to the Palmenberg lab to address this by publishing a paper describing how the commercial products introduced changes and the impact they had on the function of these altered IRES sequences (Bochkov, 2006).

Where I started: What is a good IRES sequence for use in transgenics?

I rummaged around the literature regarding IRES sequences and find there has been a debate going on as to which ones are truly functioning as IRES sites and which are “artifactual.” The debate I’m referring to deals with studies of IRES sequences rather than the use in transgenics. However, the work is relevant when choosing proven functional IRES sequences for designing transgenic constructs we are planning to invest significant time and resources in making and characterizing.

There are both viral and “cellular” sources of IRES sequences with the latter apparently gaining momentum in the more recent years. Baranick et al. (2008) reexamined several known IRES sequences using the traditional assays as well as RTPCR to confirm the polycistronic nature of the transcripts. What they found was presence of cryptic splice sites in these IRES sequences that contribute to the observed IRES behavior. In other words, the improved performance of some is not due to a better IRES sequence, but rather splicing events that the standard assay (two reporters, e.g. luciferase and GFP, linked by an IRES) does not distinguish. When they mutated the splice sites and reduced the splicing events, as determined by RTPCR, the level of protein expression from the second coding region was also reduced.

Where I landed: So what should we use?

The more common IRES used in expression constructs is derived from the EMCV viral genome. Some groups have successfully used the IRES from Eif4g in mouse transgenics. What we decided to use was the canonical sequence from the EMCV used by several labs successfully (e.g. the Cepko Lab).

CODE used in our constructs

We used the pWPI plasmid designed by the Trono lab (see Addgene plasmid 12254) as a source of the IRES sequence, and one of the construct components we designed and made for use in transgenics – myrTagRFPT-ires-CE (note the “CE” stands for CreERT2). The sequence is also listed below.

The IRES in these is 563 nucleotides in length and identical to the sequence described in the Palmenberg paper for the minimum IRES except a couple nucleotides longer in the poly C stretch at the start. The 5’ end of the IRES permits some length variability as noted in that paper.

pWPI (3516bp - 4078bp, direct) 563bp    CCCCCCCCCCTAACGTTACTGGCCGAAGCCGCTTGGAATAAGGCCGGTGTGCGTTTGTCTATATGTTATTTTCCACCATATTGCCGTCTTTTGGCAATGTGAGGGCCCGGAAACCTGGCCCTGTCTTCTTGACGAGCATTCCTAGGGGTCTTTCCCCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCTGGAAGCTTCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACCCCCCACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCACGTGTATAAGATACACCTGCAAAGGCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGGAAAGAGTCAAATGGCTCTCCTCAAGCGTATTCAACAAGGGGCTGAAGGATGCCCAGAAGGTACCCCATTGTATGGGATCTGATCTGGGGCCTCGGTGCACATGCTTTACATGTGTTTAGTCGAGGTTAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTTGAAAAACACGATGATAATACCATGG  

(note the ACCATGG is the start of the next protein )

Transgenic strains generated as part of the GUDMAP project can be found in the GUDMAP.org-Resources section.

Bibliography

Baranick, B.T., Lemp, N.A., Nagashima, J., Hiraoka, K., Kasahara, N., and Logg, C.R. (2008). Splicing mediates the activity of four putative cellular internal ribosome entry sites. Proc Natl Acad Sci USA 105, 4733–4738.

Bochkov, Y.A., and Palmenberg, A.C. (2006). Translational efficiency of EMCV IRES in bicistronic vectors is dependent upon IRES sequence and gene location. BioTechniques 41, 283–284, 286, 288.

Flodby, P., Borok, Z., Banfalvi, A., Zhou, B., Gao, D., Minoo, P., Ann, D.K., Morrisey, E.E., and Crandall, E.D. (2010). Directed expression of Cre in alveolar epithelial type 1 cells. Am J Respir Cell Mol Biol 43, 173–178.

Henry, S.P., Jang, C.-W., Deng, J.M., Zhang, Z., Behringer, R.R., and de Crombrugghe, B. (2009). Generation of aggrecan-CreERT2 knockin mice for inducible Cre activity in adult cartilage. Genesis 47, 805–814.

Kamoshita, N., Nomoto, A., and RajBhandary, U.L. (2009). Translation initiation from the ribosomal A site or the P site, dependent on the conformation of RNA pseudoknot I in dicistrovirus RNAs. Mol Cell 35, 181–190.

Matsuda, T., and Cepko, C.L. (2004). Electroporation and RNA interference in the rodent retina in vivo and in vitro. Proc Natl Acad Sci USA 101, 16–22.

Van Eden, M.E., Byrd, M.P., Sherrill, K.W., and Lloyd, R.E. (2004). Demonstrating internal ribosome entry sites in eukaryotic mRNAs using stringent RNA test procedures. Rna 10, 720–730.